Copyright © 2004 by the Johns Hopkins Bloomberg School of Public Health
ORIGINAL CONTRIBUTIONS |
CYP1A1, Cigarette Smoking, and Colon and Rectal Cancer
1 Health Research Center, University of Utah Health Sciences Center, Salt Lake City, UT.
2 Department of Pathology, School of Medicine, University of Utah, Salt Lake City, UT.
3 Division of Research, Kaiser Permanent Medical Care Program, Oakland, CA.
4 Division of Epidemiology, Department of Medicine, University of California, Irvine, CA.
Received for publication January 21, 2004; accepted for publication May 26, 2004.
| ABSTRACT |
|---|
|
|
|---|
Cytochrome P-450 (CYP) is involved in the activation and metabolism of polycyclic aromatic hydrocarbons in tobacco products. The authors evaluated the association of two polymorphisms in the CYP1A1 genethe noncoding Msp I polymorphism in the 3'-untranslated region and the Ile462Val polymorphism in exon 7with colon and rectal cancer. The authors used data from two incident case-control studies of colon cancer (1,026 cases and 1,185 controls) and rectal cancer (820 cases and 1,036 controls) conducted in California and Utah (19912002). CYP1A1 genotype was not associated with colon or rectal cancer. Having GSTM1 present, a CYP1A1 variant allele, and the rapid-acetylator NAT2 imputed phenotype was associated with increased risk of colon cancer (odds ratio = 1.7, 95% confidence interval: 1.2, 2.3). Among men, the greatest colon cancer risk was observed for having any CYP1A1 variant allele and currently smoking (odds ratio = 2.5, 95% confidence interval: 1.3, 4.8; Wald
2 test: p < 0.01). Assessment of GSTM1 and CYP1A1 and rectal cancer in men showed a twofold elevation in risk for more than 20 pack-years of smoking, except among those with GSTM1 present who had a variant CYP1A1 allele. These data support the association between smoking and colon and rectal cancer. Smoking may have a greater impact on colorectal cancer risk based on CYP1A1 genotype; this might further be modified by GSTM1 for rectal cancer risk.
arylamine N-acetyltransferase; colorectal neoplasms; cytochrome P-450 CYP1A1; GSTM1 protein; smoking; tobacco
Abbreviations: Abbreviations: CYP, cytochrome P-450; GST, glutathione S-transferase; NAT, N-acetyltransferase; PCR, polymerase chain reaction.
| INTRODUCTION |
|---|
|
|
|---|
Cytochrome P-450s (CYPs) are enzymes involved in the oxidative metabolism of many substances, including steroids, fatty acids, prostaglandins, biogenic amines, and plant metabolites (1). These enzymes also metabolize chemical carcinogens, mutagens, and other environmental contaminants. CYPs are phase I metabolizing enzymes in which the substrate is oxidized; phase II metabolizing enzymes often use the oxygen as a site for further metabolism into an excretable product. CYP1A1 is key to the metabolic activation of polycyclic aromatic hydrocarbons (such as those found in cigarette smoke), which are considered carcinogenic (2).
Two polymorphisms of the CYP1A1 gene have been examined with regard to cancer susceptibility: a T
C transition in the 3'-untranslated region which creates a MspI restriction site and an A
G transition leading to a substitution of valine for isoleucine at codon 462 (Ile462Val) (36). These polymorphisms have been associated with increased activity of the enzyme, and increased carcinogen activation would be expected to increase the risk of cancer. The Ile462Val variant was found in one study to significantly increase CYP1A1 inducibility (7, 8), whereas in another study, it appeared to not be functionally important (9). For the CYP1A1 MspI variant, increased CYP1A1 inducibility was reported for persons with the variant genotype in one study (10) but not in another (7). In one study, there were significantly higher adduct levels in white blood cells among persons homozygous for the variant (11). In a Japanese population, the Ile462Val variant was associated with a threefold increased risk of lung cancer among smokers (12), though there was no association in a study conducted in Finland (5). These rare CYP1A1 alleles were associated with a significantly increased risk of colorectal cancer in Japanese populations, though similar associations were not detected in other studies (4, 1315). Although data are limited, CYP1A1 genotype may be important in the etiology of colon and rectal cancer, either through a combined influence with other genes involved in metabolizing carcinogens or through alterations in susceptibility to tobacco use.
There is evidence that cigarette smoking may result in a modestly increased risk of colorectal cancer in general and a specifically increased risk of tumors with microsatellite instability (1619). Studies have shown that both the amount smoked and age at starting to smoke may be important etiologically. Given these observations, it is of interest to determine whether genetic susceptibility plays a role in the observed association between cigarette smoking and development of colorectal cancer. Several genes coding for enzymes involved in the metabolism of carcinogens are known to be polymorphic, including genes coding for glutathione S-transferase (GST) and N-acetyltransferase (NAT), in addition to the CYP1A1 gene. A deletion of both copies of GSTM1 is fairly common and might be expected to lead to an increased risk of cancer due to an inability to detoxify carcinogens via this pathway. Studies that have evaluated the relation of GST and NAT2 genotypes with risk of colorectal cancer have not consistently found variability in colorectal cancer risk by genotype in the presence of tobacco use. Our previous studies of colon and rectal cancer did not show significant interaction between GSTM1, NAT2, and smoking in terms of risk (19, 20). However, the effect of these metabolizing enzymes may be influenced by the CYP1A1 gene, because it regulates substrate to enzymes such as GST and NAT2. Few studies have evaluated the association between CYP1A1 genotype and colorectal cancer, although, given the biologic properties of CYP1A1, it is possible that CYP1A1 genotype alone or in combination with GST and NAT2 genotype may define a group of persons who are genetically susceptible to smoking-related cancers.
In this analysis, we examined the association between CYP1A1 genotype and risk of colorectal cancer. We hypothesized that having a CYP1A1 variant allele and its associated increased activation of polycyclic aromatic hydrocarbons, in combination with being GSTM1-negative (null), with its associated decreased ability to detoxify activated polycyclic aromatic hydrocarbons, would increase risk of colorectal cancer. We also hypothesized that having the CYP1A1 variant allele in combination with being a rapid acetylator would increase colorectal cancer risk. We evaluated the potential effect modification of CYP1A1 genotype on cigarette smoking and evaluated the influence of CYP1A1 on the colorectal cancer risk associated with GSTM1 genotype or NAT2 imputed phenotype. We used data from two large population-based case-control studies of colorectal cancer.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Study population
Participants in this analysis were selected from two populations: members of the Kaiser Permanente Medical Care Program of Northern California and residents of the state of Utah. All eligible persons with incident cases in these defined populations were identified and recruited for the study. Cases with a first primary tumor in the rectosigmoid junction or rectum were identified between May 1997 and May 2001 (21); cases with first primary colon cancer were identified between October 1991 and September 1994 (22). Case eligibility was determined through the Surveillance, Epidemiology, and End Results cancer registries in Northern California and Utah. Cases were identified using rapid-reporting systems. To be eligible, cases could not have had a previous colorectal tumor, had to be between 30 and 79 years of age at diagnosis, had to be able to speak English, and had to be sufficiently mentally competent to complete the interview. Cases with known (as indicated on the pathology report) familial adenomatous polyposis, ulcerative colitis, or Crohns disease were not eligible. An additional criterion for eligibility for the colon cancer study was being non-Hispanic White, Hispanic, or African-American; in the rectal cancer study, Asians and Native Americans were also included.
Controls were matched to cases by sex and 5-year age group, using the same eligibility criteria as those used for cases. In the group from the Kaiser Permanente Medical Care Program, controls were randomly selected from membership lists. In the group from Utah, controls aged 65 years or more were randomly selected from Health Care Financing Administration lists; controls younger than age 65 years were randomly selected from drivers license lists.
Of the 952 cases and 1,205 controls from the rectal cancer study (21), 820 cases and 1,036 controls were interviewed between October 1997 and January 2002 and had DNA available for analysis. Of the 1,346 colon cancer cases and 1,544 controls (22) interviewed between March 1992 and May 1995 in the same geographic areas as participants in the rectal cancer study, 1,026 cases and 1,185 controls had DNA available. For the rectal cancer study, the response rate (number of people interviewed out of all people identified) was 65.2 percent for cases and 65.3 percent for controls; for the colon cancer study, the response rate was 71.8 percent for cases and 68.0 percent for controls. The primary reason for nonresponse was participant refusal, though approximately 1015 percent of cases either had died prior to our being able to interview them or were too sick to be interviewed.
Data collection
Data were collected by trained and certified interviewers using laptop computers. Data for the rectal cancer study were collected using the same study questionnaire and the same quality control procedures as were described for our colon cancer study (23). Study participants were asked to recall the year 2 years prior to the date of selection (the date of diagnosis for cases or the date of selection for controls). The interview took approximately 2 hours to complete.
Cigarette smoking history
Information was obtained about use of cigarettes, cigars, and pipes during the referent year (2 years prior to interview or selection) and 10 and 20 years prior to the interview. Information was obtained about ever using these tobacco products on a regular basis, which was defined as smoking at least 100 cigarettes in a lifetime or regularly using cigars or pipes for at least 1 year. Data on age at starting and stopping use of these tobacco products and usual number of cigarettes, cigars, or pipes smoked per day were obtained. Since some people do not smoke continuously, we also asked about total number of years of smoking. We determined pack-years of cigarette smoking by multiplying the usual number of cigarettes smoked per day with the total number of years of smoking and dividing by 20 (the number of cigarettes in one pack). We obtained data on exposure to environmental tobacco smoke by asking about the usual number of hours per week in which the participant was exposed to smoke inside the house and outside of the house for the referent period and 10 and 20 years previously.
Other information
Other information obtained included data on moderate and vigorous physical activity performed over the past 20 years, reported height and weight 2 years prior to selection/diagnosis, long-term alcohol use, family history of cancer, use of aspirin and nonsteroidal antiinflammatory drugs, reproductive history, and dietary intake. We also obtained more detailed information on alcohol consumption during the referent year.
Genetic data
Blood was drawn from study participants and DNA was extracted. The GSTM1 null genotype was detected using the polymerase chain reaction (PCR) method described by Zhong et al. (24). Three variants of the NAT2 gene were assessed, using the method of Bell et al. (25) to determine acetylator status. These three variants account for approximately 9095 percent of the slow-acetylation phenotype in Caucasians. All three variants could be identified from one PCR product that is digested with three different restriction enzymes. The C481T variant was determined using a KpnI restriction digest; the G590A variant was determined using a TaqI restriction digest; and the G857A variant was determined using a BamHI restriction digest. Persons with at least two variant alleles were classified as slow acetylators. Those with one variant allele or no variant alleles were classified as fast acetylators. The methods used have been described in detail elsewhere (19, 26).
The CYP1A1 T
C transition in the 3'-untranslated region was detected using the PCR method described by Hayashi et al. (27), in which the 343-base-pair PCR product was digested with MspI. The common allele (T) is uncut and is approximately 340 base pairs long. The C allele is digested and leads to two smaller bands of 200 base pairs and 140 base pairs.
The CYP1A1 A4889G (Ile462Val) polymorphism was detected using allele-specific PCR and was performed with one upstream primer and two downstream primers as described by Rebbeck et al. (28), with the following modifications. The downstream primer specific for the uncommon allele (G) was modified with a GC clamp to increase the melting temperature (CGCCCGCCGCCGCCCGCCGCGTGTATCGGTGAGACCG); the downstream primer specific for the common allele (A) was the same as that in the article by Rebbeck et al. (28) (GAAGTGTATCGGTGAGACCA). The common upstream primer used was TTCCACCCGTTGCAGCAGGATAGCC (15). PCR was performed, and the results were analyzed using the iCycler iQ Real-Time PCR Detection System (Bio-Rad, Hercules, California). The PCR procedure entailed 35 cycles of 15 seconds each at 95°C, 61°C, and 72°C. This was followed by 10 seconds at 95°C and then by 80 cycles of half-degree decrements for 10 seconds for analysis of melting temperature. The melting temperature of the common allele was 85.5°C, while the melting temperature of the uncommon (G) allele, because of the GC clamp, was 90.5°C. This assay utilizes Sybr green dye and the 2.3 version of the Bio-Rad software. Any genotype with a G allele was verified by PCR amplification with the primers CTGTCTCCCTCTGGTTACAGGAAG (15) and GGCACGCTGAATTCCACgCaaTGCAGCAGGATAGC (with added BsrDI site lowercase letters); this was then followed by BsrDI restriction digestion. PCR conditions for this reaction were the same as those for the above iCycler reaction, except that 30 cycles were performed. The uncut product is 215 base pairs in length. The G allele leads to loss of the restriction site and a 192-base-pair band due to digestion of the control BsrDI site. Amplicons with the A allele are further digested to 149/43 base pairs.
Statistical analysis
The distribution of the CYP1A1 genotypes was assessed. Additional analysis was conducted using a classification from both CYP1A1 genotypes to determine the number of variant alleles versus no variant alleles (i.e., C vs. T and V vs. I). We evaluated genotype status according to current cigarette smoking status (never, former, and current smoking), pack-years of cigarette smoking, usual number of cigarettes smoked per day, and number of years of having smoked. Although information on cigar and pipe smoking was available, numbers of subjects were too low for us to evaluate genotype information for these forms of tobacco use. We evaluated associations using unconditional multiple logistic regression models with adjustment for age at diagnosis or selection, body size, physical activity patterns, and alcohol intakefactors that could be associated with tobacco smoking as well as with colon and rectal cancer. Although 820 rectal cancer cases and 1,036 controls and 1,026 colon cancer cases and 1,185 controls had DNA available for analyses, numbers varied slightly because of missing exposure data or failure to obtain genotype data; numbers for specific tests are provided in the tables. Odds ratios and 95 percent confidence intervals were calculated. We report associations for cigarette smoking according to smoking status (never, former, or current smoking), usual number of cigarettes smoked per day, number of years of having smoked, and pack-years of smoking. These associations are reported for easy reference in evaluating interactions, although associations with cigarette smoking have been previously reported (19, 29). We assessed interaction between smoking and genotype by including a cross-product term in the model for multiplicative interaction along with the independent smoking and genotype variables, as well as by assessing additive interaction using methods proposed by Hosmer and Lemeshow (30); we also assessed the differences in slopes associated with smoking by genotype using a Wald
2 test.
| RESULTS |
|---|
|
|
|---|
Approximately twice as many cases and controls interviewed for the rectal cancer study were under 50 years of age as for the colon cancer study (table 1). The majority of cases and controls were male and non-Hispanic White. Most of those who had ever smoked were not current smokers.
|
In the control population, the allele frequency for the C allele at the MspI locus was 11 percent in non-Hispanic Whites, 28 percent in Hispanics, 31 percent in African Americans, and 37 percent in Asians; the allele frequency for the T allele was 89 percent in Whites, 72 percent in Hispanics, 69 percent in African Americans, and 63 percent in Asians. The allele frequency for the I allele of the 462 locus was 97 percent in non-Hispanic Whites, 81 percent in Hispanics, 98 percent in African Americans, and 82 percent in Asians; the V allele frequency was 3 percent in non-Hispanic Whites, 19 percent in Hispanics, 2 percent in African Americans, and 18 percent in Asians. Both the MspI (T3801C) polymorphism and the I462V polymorphism were in Hardy-Weinberg equilibrium.
Neither CYP1A1 polymorphism was associated with rectal or colon cancer (table 2). Combinations of GSTM1 and CYP1A1 and NAT2 imputed phenotype and CYP1A1 genotype also were not associated with colon or rectal tumors. Simultaneous evaluation of all three genotypes showed the strongest statistically significant increased risk of colon cancer for having GSTM1 present, CYP1A1Wt (wild type), and the rapid-acetylator NAT2 imputed phenotype (odds ratio = 1.7, 95 percent confidence interval: 1.2, 2.3).
|
Associations between cigarette smoking and rectal and colon cancer are shown in table 3. Associations were strongest for current smokers. Amount smoked per day was a slightly stronger predictor of colon cancer risk than pack-years of smoking, though pack-years of smoking appeared to be the best cigarette-related predictor of rectal cancer risk.
|
Among men with colon cancer, there was a borderline-significant interaction between CYP1A1 and cigarette smoking status (for additive interaction, p = 0.07; for Wald
2 test of slope, p < 0.01) (table 4), with a 2.5-fold increased risk (95 percent confidence interval: 1.3, 4.8) observed among males who were current smokers and had at least one rare CYP1A1 allele from either genotype. Associations with smoking were more similar for women and men for colon cancer than for rectal cancer, where associations between smoking and cancer were seen only for men (table 5). For rectal cancer, men at greatest risk were those with more than 20 pack-years of cigarette smoking, regardless of CYP1A1 genotype. There was no indication of increased rectal cancer risk by cigarette smoking or CYP1A1 genotype among women.
|
|
We evaluated the combined effects of the GSTM1 and CYP1A1 genotypes and of the combined NAT2 imputed phenotype and CYP1A1 genotype in conjunction with cigarette smoking (table 6). For rectal cancers, the only genotype that was not associated with increased risk of cancer in conjunction with pack-years of smoking was having GSTM1 present and having any variant CYP1A1 allele. However, the interaction between cigarette smoking status and the combined GSTM1 and CYP1A1 genotypes was not statistically significant. There were no significant associations between GSTM1, CYP1A1, or cigarette smoking and colon cancer risk. Evaluation of the combined NAT2 imputed phenotype and CYP1A1 genotype with cigarette smoking showed no significant interaction. For rectal cancer, pack-years of smoking appeared to have a greater impact on risk than NAT2/CYP1A1 combined genotypes. Associations for colon cancer for women were similar to those reported for men; however, for rectal cancer, associations were much weaker for women, and thus there was minimal alteration in risk associated with smoking for any genotype combination when data for men and women were combined. Associations were similar for various indicators of tobacco use, including being a current, former, or never smoker, amount usually smoked, and years of having smoked cigarettes.
|
| DISCUSSION |
|---|
|
|
|---|
These results suggest that CYP1A1 genotype is not associated with colon or rectal cancer, although we had limited statistical power to determine associations for the homozygote variant separately from those for having any variant allele. There were some suggestions of a significant interaction between cigarette smoking and CYP1A1 genotype for colon cancer and among men for rectal cancer. In our previous analysis, we observed significant associations between cigarette smoking and colon cancer and for rectal cancer among men (19, 29). Overall, cigarette smoking appeared to more consistently alter colon and rectal cancer risk than cigarette smoking in combination with genotypes.
Genes involved in the metabolic activation or inactivation of carcinogens may be important in the development of neoplasia. The CYP genes represent a family of genes that are involved in metabolizing chemical carcinogens, mutagens, and other environmental contaminants. In particular, they activate polycyclic aromatic hydrocarbons, a major carcinogen in cigarette smoke. The xenobiotics produced are then detoxified by GST and NAT such that CYP1A1 regulates phase II enzymes through the amount of substrate for the phase II enzymes. However, little is known about their association with cancer. In a study by Sivaraman et al. (4), an eightfold increased risk of colorectal cancer was observed with the MspI CYP1A1 rare allele among Japanese living in Hawaii. Some studies have shown significant interaction between tobacco use, the MspI CYP1A1 genotype rare allele, and lung cancer (31), although others have not (3). Homozygotes for the rare CYP1A1 allele are expected to be at greater risk when exposed to polycyclic aromatic hydrocarbons found in tobacco because of higher enzyme activity. Detecting an association between the CYP1A1 homozygous variant genotype and cancer will be difficult in Caucasian populations because of the low frequency of the variant alleles. In the present study, data were consistent with an increased risk of rectal cancer among subjects who were homozygous for the CYP1A1 Ill/Val variant/variant genotype (odds ratio = 1.5) or among those with four variant alleles detected (odds ratio = 2.1). However, even with our large case-control study, we were limited in our power to demonstrate significance of odds ratios of this magnitude for the rare alleles.
We simultaneously evaluated three genes that may be interrelated: CYP1A1, GSTM1, and NAT2. However, detoxification of polycyclic aromatic hydrocarbons may involve many other genes that might influence the action of the ones examined. Other genes, including other CYPs, GSTs, NAT1, and the aromatic hydrocarbon receptor gene, which positively regulates inducible expression of aromatic hydrocarbon hydroxylase, may further define genetic susceptibility to tobacco exposure. Higher levels of aromatic hydrocarbon hydroxylase have been associated with increased risk of cancer (32). Unfortunately, our sample size did not allow us to fully evaluate the multitude of genes that may work together. Simultaneous evaluation of the many genes involved would require a much larger sample than we currently have. Although the potential of combining our data from studies of colon cancer and studies of rectal cancer existed, the associations were different for the two subsites; hence our presentation of a stratified analysis.
There were several study limitations. In this study, we evaluated genotype, although phenotype may provide more information as to individual functionality and variability in the enzyme product. Genotype data may be less related to phenotype when several genes coregulate each other in a potential disease pathway. The allele and genotype frequencies reported in this study for CYP1A1 are similar to those reported in other studies (8, 14, 33, 34). Of note is the much higher frequency of the variant alleles in Hispanics and Asians. One other study reported a high frequency of the variant alleles in Hispanic populations (33). Additionally, we did not have the ability to evaluate the homozygotic variant independently of the heterozygotic variant because of the rarity of the genotype. It is possible that cigarette smoking may have a greater impact in a small subset (
2 percent) of the population because of their CYP1A1 genetic profile.
To our knowledge, this was the first large study to evaluate the relation between CYP1A1 genotype and colorectal cancer risk in conjunction with GSTM1, NAT2 imputed phenotype, and cigarette smoking practices. Although we did not observe an association between CYP1A1 genotype and colorectal cancer risk, there were increased colorectal cancer risks associated with CYP1A1 and cigarette smoking. Combinations of the CYP1A1, GSTM1, and NAT2 genotypes may further alter risk. These results also emphasize the importance of cigarette smoking as a risk factor for colon and rectal cancer.
| ACKNOWLEDGMENTS |
|---|
This study was funded by National Cancer Institute grant CA48998 to Dr. Martha Slattery. This research was also supported by the Utah Cancer Registry, which is funded by National Cancer Institute contract NO1-PC-67000, with additional support from the Utah Department of Health, the Northern California Cancer Registry, and the Sacramento Tumor Registry.
The authors acknowledge the contributions of the General Clinical Research Center at the University of Utah for processing DNA, Dr. Roger Wolff, Michael Hoffman, and Kazuko Yakumo for genotyping CYP1A1, Thao Tran for genotyping NAT2, the genotyping staff at the University of Utah for GSTM1 genotyping, Sandra Edwards for data collection, and Karen Curtin for data management.
The contents of this manuscript are solely the responsibility of the authors and do not necessarily represent the official view of the National Cancer Institute.
| NOTES |
|---|
Reprint requests to Dr. Martha Slattery, Health Research Center, University of Utah Health Sciences Center, 375 Chipeta Way, Suite A, Salt Lake City, UT 84108 (e-mail: mslatter{at}hrc.utah.edu).
| REFERENCES |
|---|
|
|
|---|
- Nebert DW, Nelson DR, Coon MJ, et al. The P450 superfamily: update on new sequences, gene mapping, and recommended nomenclature. DNA Cell Biol 1991;10:114.
[Abstract/Free Full Text] - Nebert DW. Role of genetics and drug metabolism in human cancer risk. Mutat Res 1991;247:26781.[CrossRef][Web of Science][Medline]
- Tefre T, Ryberg D, Haugen A, et al. Human CYP1A1 (cytochrome P(1)450) gene: lack of association between the Msp I restriction fragment length polymorphism and incidence of lung cancer in a Norwegian population. Pharmacogenetics 1991;1:205.[Medline]
- Sivaraman L, Leatham MP, Yee J, et al. CYP1A1 genetic polymorphisms and in situ colorectal cancer. Cancer Res 1994;54:36925.
[Abstract/Free Full Text] - Hirvonen A, Husgafvel-Pursiainen K, Karjalainen A, et al. Point-mutational MspI and Ile-Val polymorphisms closely linked in the CYP1A1 gene: lack of association with susceptibility to lung cancer in a Finnish study population. Cancer Epidemiol Biomarkers Prev 1992;1:4859.[Abstract]
- Vineis P. The relationship between polymorphisms of xenobiotic metabolizing enzymes and susceptibility to cancer. Toxicology 2002;181-182:45762.[CrossRef][Medline]
- Crofts F, Taioli E, Trachman J, et al. Functional significance of different human CYP1A1 genotypes. Carcinogenesis 1994;15:29613.
[Abstract/Free Full Text] - Cosma G, Crofts F, Currie D, et al. Racial differences in restriction fragment length polymorphisms and messenger RNA inducibility of the human CYP1A1 gene. Cancer Epidemiol Biomarkers Prev 1993;2:537.[Abstract]
- Persson I, Johansson I, Ingelman-Sundberg M. In vitro kinetics of two human CYP1A1 variant enzymes suggested to be associated with interindividual differences in cancer susceptibility. Biochem Biophys Res Commun 1997;231:22730.[CrossRef][Web of Science][Medline]
- Landi MT, Bertazzi PA, Shields PG, et al. Association between CYP1A1 genotype, mRNA expression and enzymatic activity in humans. Pharmacogenetics 1994;4:2426.[Web of Science][Medline]
- Ichiba M, Hagmar L, Rannug A, et al. Aromatic DNA adducts, micronuclei and genetic polymorphism for CYP1A1 and GST1 in chimney sweeps. Carcinogenesis 1994;15:134752.
[Abstract/Free Full Text] - Kiyohara C, Wakai K, Mikami H, et al. Risk modification by CYP1A1 and GSTM1 polymorphisms in the association of environmental tobacco smoke and lung cancer: a case-control study in Japanese nonsmoking women. Int J Cancer 2003;107:13944.[CrossRef][Web of Science][Medline]
- Ishibe N, Stampfer M, Hunter DJ, et al. A prospective study of cytochrome P450 1A1 polymorphisms and colorectal cancer risk in men. Cancer Epidemiol Biomarkers Prev 2000;9:8556.
[Free Full Text] - Inoue H, Kiyohara C, Marugame T, et al. Cigarette smoking, CYP1A1 MspI and GSTM1 genotypes, and colorectal adenomas. Cancer Res 2000;60:374952.
[Abstract/Free Full Text] - Song N, Tan W, Xing D, et al. CYP 1A1 polymorphism and risk of lung cancer in relation to tobacco smoking: a case-control study in China. Carcinogenesis 2001;22:1116.
[Abstract/Free Full Text] - Chao A, Thun MJ, Jacobs EJ, et al. Cigarette smoking and colorectal cancer mortality in the Cancer Prevention Study II. J Natl Cancer Inst 2000;92:188896.
[Abstract/Free Full Text] - Giovannucci E. An updated review of the epidemiological evidence that cigarette smoking increases risk of colorectal cancer. Cancer Epidemiol Biomarkers Prev 2001;10:72531.
[Abstract/Free Full Text] - Slattery ML, Potter JD, Friedman GD, et al. Tobacco use and colon cancer. Int J Cancer 1997;70:25964.[CrossRef][Web of Science][Medline]
- Slattery ML, Edwards S, Curtin K, et al. Associations between smoking, passive smoking, GSTM-1, NAT2, and rectal cancer. Cancer Epidemiol Biomarkers Prev 2003;12:8829.
[Abstract/Free Full Text] - Slattery ML, Curtin K, Ma K, et al. GSTM-1 and NAT2 and genetic alterations in colon tumors. Cancer Causes Control 2002;13:52734.[CrossRef][Web of Science][Medline]
- Slattery ML, Edwards S, Curtin K, et al. Physical activity and colorectal cancer. Am J Epidemiol 2003;158:21424.
[Abstract/Free Full Text] - Slattery ML, Potter J, Caan B, et al. Energy balance and colon cancerbeyond physical activity. Cancer Res 1997;57:7580.
[Abstract/Free Full Text] - Edwards S, Slattery ML, Mori M, et al. Objective system for interviewer performance evaluation for use in epidemiologic studies. Am J Epidemiol 1994;140:10208.
[Abstract/Free Full Text] - Zhong S, Howie AF, Ketterer B, et al. Glutathione S-transferase mu locus: use of genotyping and phenotyping assays to assess association with lung cancer susceptibility. Carcinogenesis 1991;12:15337.
[Abstract/Free Full Text] - Bell DA, Taylor JA, Butler MA, et al. Genotype/phenotype discordance for human arylamine N-acetyltransferase (NAT2) reveals a new slow-acetylator allele common in African-Americans. Carcinogenesis 1993;14:168992.
[Abstract/Free Full Text] - Kampman E, Slattery ML, Bigler J, et al. Meat consumption, genetic susceptibility, and colon cancer risk: a United States multicenter case-control study. Cancer Epidemiol Biomarkers Prev 1999;8:1524.[Medline]
- Hayashi SI, Watanabe J, Nakachi K, et al. PCR detection of an A/G polymorphism within exon 7 of the CYP1A1 gene. (Electronic article). Nucleic Acids Res 1991;19:4797.
[Free Full Text] - Rebbeck TR, Rosvold EA, Duggan DJ, et al. Genetics of CYP1A1: coamplification of specific alleles by polymerase chain reaction and association with breast cancer. Cancer Epidemiol Biomarkers Prev 1994;3:51114.[Abstract]
- Slattery ML, Potter JD, Friedman GD, et al. Tobacco use and colon cancer. Int J Cancer 1997;70:25964.[CrossRef][Web of Science][Medline]
- Hosmer DW, Lemeshow S. Confidence interval estimation of interaction. Epidemiology 1992;3:4526.[Web of Science][Medline]
- Taioli E, Gaspari L, Benhamou S, et al. Polymorphisms in CYP1A1, GSTM1, GSTT1 and lung cancer below the age of 45 years. Int J Epidemiol 2003;32:603.
[Abstract/Free Full Text] - Cauchi S, Stucker I, Cenee S, et al. Structure and polymorphisms of human aryl hydrocarbon receptor repressor (AhRR) gene in a French population: relationship with CYP1A1 inducibility and lung cancer. Pharmacogenetics 2003;13:33947.[CrossRef][Web of Science][Medline]
- Ishibe N, Wiencke JK, Zuo ZF, et al. Susceptibility to lung cancer in light smokers associated with CYP1A1 polymorphisms in Mexican- and African-Americans. Cancer Epidemiol Biomarkers Prev 1997;6:107580.[Abstract]
- Ishibe N, Stampfer M, Hunter DJ, et al. A prospective study of cytochrome P450 1A1 polymorphisms and colorectal cancer risk in men. Cancer Epidemiol Biomarkers Prev 2000;9:8556.
[Free Full Text]
This article has been cited by other articles:
![]() |
E. Botteri, S. Iodice, V. Bagnardi, S. Raimondi, A. B. Lowenfels, and P. Maisonneuve Smoking and Colorectal Cancer: A Meta-analysis JAMA, December 17, 2008; 300(23): 2765 - 2778. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pande, C. I. Amos, D. R. Osterwisch, J. Chen, P. M. Lynch, R. Broaddus, and M. L. Frazier Genetic Variation in Genes for the Xenobiotic-Metabolizing Enzymes CYP1A1, EPHX1, GSTM1, GSTT1, and GSTP1 and Susceptibility to Colorectal Cancer in Lynch Syndrome Cancer Epidemiol. Biomarkers Prev., September 1, 2008; 17(9): 2393 - 2401. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Paskett, K. W. Reeves, T. E. Rohan, M. A. Allison, C. D. Williams, C. R. Messina, E. Whitlock, A. Sato, and J. R. Hunt Association Between Cigarette Smoking and Colorectal Cancer in the Women's Health Initiative J Natl Cancer Inst, November 21, 2007; 99(22): 1729 - 1735. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Young, M. Jenkins, S. Parry, B. Young, D. Nancarrow, D. English, G. Giles, and J. Jass Serrated pathway colorectal cancer in the population: genetic consideration Gut, October 1, 2007; 56(10): 1453 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Luchtenborg, K. K.L. White, L. Wilkens, L. N. Kolonel, and L. Le Marchand Smoking and Colorectal Cancer: Different Effects by Type of Cigarettes? Cancer Epidemiol. Biomarkers Prev., July 1, 2007; 16(7): 1341 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Goode, J. D. Potter, W. R. Bamlet, D. N. Rider, and J. Bigler Inherited variation in carcinogen-metabolizing enzymes and risk of colorectal polyps Carcinogenesis, February 1, 2007; 28(2): 328 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sinha, M. Kulldorff, M. J. Gunter, P. Strickland, and N. Rothman Dietary Benzo[a]Pyrene Intake and Risk of Colorectal Adenoma Cancer Epidemiol. Biomarkers Prev., August 1, 2005; 14(8): 2030 - 2034. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Gunter, M. A. Watson, A. S. Loktionov, P. Mitrou, T. Cecil, C. Macklin, C. Cardwell, D. T. Bishop, J. Primrose, W. S. Atkin, et al. No Association between Cytochrome P450 and Glutathione S-Transferase Gene Polymorphisms and Risk of Colorectal Adenoma: Results from the UK Flexible Sigmoidoscopy Screening Trial Cancer Epidemiol. Biomarkers Prev., April 1, 2005; 14(4): 1028 - 1030. [Full Text] [PDF] |
||||
![]() |
M. A. Murtaugh, C. Sweeney, K.-n. Ma, B. J. Caan, and M. L. Slattery The CYP1A1 Genotype May Alter the Association of Meat Consumption Patterns and Preparation with the Risk of Colorectal Cancer in Men and Women J. Nutr., February 1, 2005; 135(2): 179 - 186. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
and risk of colon cancer, Northern California and Utah, 19912002





