Am J Epidemiol 2003; 158:69-76.
Copyright © 2003 by Johns
Hopkins Bloomberg School of Public Health
ORIGINAL CONTRIBUTIONS |
Retinoic Acid Receptor Alpha Gene Variants, Multivitamin Use, and Liver Intake as Risk Factors for Oral Clefts: A Population-based Case-Control Study in Denmark, 19911994
1 Department of Biomedical Sciences, Baylor College of Dentistry, The Texas A&M University System Health Science Center, Houston, TX.
2 Institute of Biosciences and Technology, The Texas A&M University System Health Science Center, Houston, TX.
3 Department of Pediatrics, University of Iowa, Iowa City, IA.
4 Center for Prevention of Congenital Malformations, Institute of Public Health, University of Southern Denmark, Odense, Denmark.
Received for publication March 5, 2002; accepted for publication January 9, 2003.
| ABSTRACT |
|---|
|
|
|---|
Previous studies suggest that the risks of nonsyndromic cleft lip with or without cleft palate (CL±P) and isolated cleft palate are influenced by variation at several loci and that these loci interact with environmental factors to determine disease risk. One putative genetic risk factor for these conditions is the retinoic acid receptor alpha (RARA) locus, which is involved in cell-specific responses to retinoic acid. Hence, RARA may influence disease risk via an interaction with vitamin A and related compounds. Data from a Danish case-control study (19911994) were used to evaluate the relations between oral clefts, RARA, and maternal vitamin A exposure from multivitamins and liver. Analyses provided no compelling evidence that the risks of CL±P or isolated cleft palate are related to the RARA variant analyzed. Consistent with several previous studies, the authors analyses indicated that maternal multivitamin supplement use protects against CL±P. Within the range observed in this population, higher levels of vitamin A intake from multivitamins and liver sources also seemed to protect against CL±P. Exploratory analyses suggested that the latter association was not entirely explained by the association between CL±P and multivitamin use, indicating that adequate levels of vitamin A may be required for normal development of the primary palate.
case-control studies; cleft lip; cleft palate; genetics; pregnancy; receptors, retinoic acid; vitamins
Abbreviations: Abbreviations: CI, confidence interval; CL±P, cleft lip with or without cleft palate; CP, isolated cleft palate; OR, odds ratio; RARA, retinoic acid receptor alpha; RE, retinol equivalents.
| INTRODUCTION |
|---|
|
|
|---|
Nonsyndromic cleft lip with or without cleft palate (CL±P) and isolated cleft palate (CP) are thought to be determined by the interplay of genetic and environmental factors. However, environmental risk factors for these conditions remain largely elusive (1), and reported genetic associations have tended to be weak and difficult to replicate (2). The difficulty in identifying individual risk factors for these conditions has spurred interest in the assessment of gene-environment interactions that may contribute to the risk of CL±P and CP. One such interaction that has been suggested involves the retinoic acid receptor alpha (RARA) locus and exposure to vitamin A (3). That such an interaction might influence the risk of these conditions is suggested by 1) studies indicating that the risk of CL±P may vary across RARA genotypes by approximately twofold (35), 2) the involvement of RARA in cell-specific responses to retinoic acid (6), and 3) the teratogenic effects of high doses of vitamin A as retinol and retinyl esters (7).
Vitamin A is an essential nutrient for normal cellular function, including reproduction and development. However, exposure of the embryo to high doses of vitamin A produces a constellation of defects, including cleft lip and palate, in a range of animal models. Similar malformations are seen in human infants exposed to isotretinoin, a synthetic relative of vitamin A, and have also been observed in association with exposure to high doses≥25,000 IU/dayof vitamin A from supplements. An increased risk of malformations in the offspring of women who consumed more than 10,000 IU/day of vitamin A via supplements or food sources has also been reported (8) but has not been supported by other epidemiologic investigations (912).
The present study was undertaken to determine whether variation in the RARA gene, maternal intake of vitamin A as retinol and retinyl esters, or their interaction is associated with either CL±P or CP. The underlying hypothesis was that susceptibility to vitamin A teratogenicity is modulated by RARA genotype, such that vitamin A levels of <25,000 IU/day would be teratogenic to a subset of embryos defined by RARA genotype. Denmark provides an ideal setting for assessing such an interaction because consumption levels of liver and liver products are high in this country. Liver and liver products are significant dietary sources of vitamin A: estimates of median daily vitamin A intake, obtained from a 2-day dietary survey, were two- to fourfold higher for women who reported consumption of liver or liver products than for those who did not (13). Moreover, consumption of liver/liver products is associated with increased plasma levels of the retinol and retinyl ester metabolites (e.g., all-trans-retinoic acid, 13-cis-retinoic acid) responsible for the teratogenic effects of vitamin A (14, 15).
| MATERIALS AND METHODS |
|---|
|
|
|---|
This study was based on data obtained during a nationwide, 3-year case-control study of CL±P and CP conducted in Denmark (16, 17). First-trimester maternal exposure information was obtained by interview and from birth records. Infant DNA samples were obtained from newborn screening blood spots. Study approval was obtained from the Danish Scientific-Ethical Committees.
All women who delivered a liveborn child with CL±P or CP and no other major malformation or syndrome in Denmark from December 1, 1991, to August 31, 1994, were eligible to be case mothers. A woman was eligible only if she and the childs father spoke Danish fluently. All 53 hospitals in which births took place in Denmark during this time participated in the study.
The mothers of the two preceding children born in the hospital where the case mother had delivered were selected as controls. A woman was eligible to serve as a control only if her child had no major malformation and was liveborn and if she and the childs father spoke Danish fluently. If all of these criteria were not met, the mother of the next preceding child born in the hospital was selected. If an eligible woman did not wish to participate in the study, another control was not selected.
Interviews
In Denmark, treatment of facial clefts is centralized and includes a hospital visit by a nurse within the first day(s) after an affected child is born. A second home visit by the same nurse occurs approximately 2 weeks after the initial contact. These nurses (n = 12) acted as the study interviewers.
A mother was included in the study only if her child was alive at the time planned for the interview. Case mothers were interviewed during their second visit with the study nurse, which usually took place 2 weeks after delivery. Control mothers were often interviewed in the hospital when the nurse first visited the case mother. If a control mother had already been discharged from the hospital, she was interviewed in her home, usually within a few weeks of delivery.
The study questionnaire focused on maternal exposures in the first trimester of pregnancy, and it included questions on cigarette smoking, alcohol consumption, and use of multivitamin supplements. Approximately 1 year into the study, questions about consumption of liver and liver paste sandwiches were added to the questionnaire. Specifically, women were asked to recall the number of times per month that they had had a meal that included liver. In addition, they were asked to recall the number of open-faced liver paste sandwiches typically consumed per week. Liver paste sandwiches are a popular Danish lunch food, and it is not uncommon to consume one or more sandwiches daily. Information on the brand name and vitamin A content of multivitamin supplements was not obtained, nor was portion size for liver products.
Exposure measurement
First-trimester exposure to vitamin A was defined with respect to each of the three primary exposure variables: multivitamin use, liver meals, and liver paste sandwiches. Information about the first day of the last menstruation and a calendar were used to identify the dates that delimited the first trimester. Multivitamin use was evaluated as a dichotomous variable (<daily use/daily use) because of the small number of women reporting irregular use (16 tablets/week). Consumption of liver meals was also evaluated only as a dichotomous variable (yes/no), since relatively few subjects reported consuming more than one liver meal monthly. Consumption of liver paste sandwiches was analyzed both as a continuous (number of sandwiches/week) and a dichotomous (yes/no) variable.
Average daily dose of vitamin A was calculated from the data on multivitamin use and consumption of liver products. The vitamin A content of all multivitamin supplements was estimated to be 800 retinol equivalents (RE; 1 RE = 3.3 IU retinol), the standard dose in Denmark. The vitamin A content of a liver meal was estimated to be 15,000 RE based on an average portion of 150 g, and an average liver paste sandwich was estimated to contain 15 g of paste and provide 750 RE (18, 19). Liver paste contains a mixture of ingredients. In Denmark, the primary liver source for this product is pig (young adult animals), with no more than 5 percent from sows (mature female animals). The liver used in liver paste is particularly high in vitamin A: on average, 11,000 RE/100 g of pig liver and up to 60,000 RE/100 g of sow liver (18).
Initially, an average monthly dose (assuming a 28-day month) of vitamin A was calculated. Average daily vitamin A intake from liver sources and multivitamins was obtained by dividing monthly vitamin A intake by 28. Average daily exposure to vitamin A from liver sources only was estimated analogously.
Genotyping
DNA for case and control infants was obtained from newborn screening cards. Cases and controls were genotyped for a single nucleotide polymorphism (T to C) located 64 base pairs upstream of exon nine of the RARA gene. This variant was detected using single-strand confirmational polymorphism analysis by amplifying a 177 base-pair fragment using primers RS158 (GGCTCGTGTCAAAGAACTGAATCC) and RS122 (GGGATCTCCATCTTCAGCGTG). Standard polymerase chain reaction conditions were used with a 55°C annealing temperature and a 72°C amplification temperature for 35 cycles. The complete nucleotide sequence for RARA can be found under accession number AF088895 in the GenBank database (National Institutes of Health, Bethesda, Maryland) at the National Center for Biotechnology Information (http:/www.ncbi.nlm.nih.gov/Genbank/index.html).
Genotypes were read and interpreted blinded to the case/control status of samples and were repeated when inadequate or uninterpretable results occurred on the first assay. All samples were independently read by two persons, and discrepancies were resolved by repeat assay or reinterpretation.
Statistical analysis
Epileptic women were excluded from these analyses (two controls, three CL±P case mothers, one CP case mother). In addition, one member of each of 18 twin pairs (two concordant affected, eight discordant, and eight concordant unaffected) was excluded from these analyses. When the members of the twin pair were concordant, one twin was randomly excluded. Among discordant twin pairs, the unaffected twin was excluded and the affected twin was retained as a case.
Statistical analyses were performed by using SAS, release 8.01 (20) and EpiInfo, version 6 (21) software. Genotype frequencies in controls were examined for departures from Hardy-Weinberg equilibrium by using Fishers exact test. Associations between infant RARA genotype and CL±P or CP were measured by using odds ratios and exact 95 percent confidence intervals.
Unconditional logistic regression analyses were used to evaluate the associations between CL±P or CP and the primary exposure variablesmultivitamin use (<daily use/daily use), liver meals (yes/no), and liver paste sandwiches (number of sandwiches/week and yes/no)and the two summary measures of vitamin A exposureaverage vitamin A exposure from supplements plus liver products and average daily vitamin A exposure from liver products only. The logistic regression analyses were conducted by using data from only the subgroup of study subjects who were asked questions about liver consumption, and they were performed with and without adjustment for exposure to maternal cigarette smoking (number of cigarettes per day: 0, 19, 1019, ≥20) and maternal alcohol consumption (number of drinks per week: 0, 12, >2).
Potential interactions involving vitamin A exposure and RARA genotype were also assessed. Unconditional logistic regression analyses were used to evaluate the evidence for interaction on a multiplicative scale. Specifically, the likelihood ratio test was used to compare the fit of the logistic regression model that included the main effects of vitamin A and RARA as well as their interaction with the model that included only the main effects of these variables. In addition, the synergy index and its 95 percent confidence interval were used to assess the evidence for interaction on an additive scale (22).
All analyses were performed separately for CL±P and for CP since these conditions are known to have at least partially different etiologies. All p values are two sided, and, for all analyses, p < 0.05 was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
Interviews were completed with the mothers of 567 control and 302 case (222 CL±P, 80 CP) infants, representing 94 percent and 96 percent of the eligible controls and cases, respectively. Control mothers were interviewed an average of 5 days sooner after giving birth than were case mothers (9 vs. 14 days, respectively). Information on liver consumption was obtained from 72 percent of control and 71 percent of case mothers. Informed consent to use part of the newborn screening card for genotyping was provided for 84.0 percent of control infants and 88.4 percent of case infants.
As reported previously (16), mothers of CL±P case infants were more likely than mothers of control infants to report that they smoked during the first trimester of pregnancy (table 1). An association with maternal smoking was not observed for CP cases, and neither CL±P nor CP was associated with maternal first-trimester consumption of alcohol.
|
The genotypic distribution of the RARA marker in controls (table 1) was not significantly different from that expected under Hardy-Weinberg equilibrium (p = 0.79). The CC genotype was observed in less than 1 percent of controls and was not present in either case group. Because the small number of subjects with the CC genotype precluded analysis of this subset and there was no a priori basis for pooling subjects with this genotype with the heterozygotes, data on the two controls with this genotype were omitted from subsequent analyses.
CL±P
The odds ratio for the association between exposure to the rarer RARA CT genotype and CL±P was 1.30 (95 percent confidence interval (CI): 0.67, 2.45) (table 1). Therefore, this variant does not appear to be an important, independent determinant of CL±P in this population.
Mothers of control infants were more likely to report daily use of multivitamin supplements than were mothers of CL±P infants (table 1). Comparison of women who reported daily use with those reporting less than daily use provided evidence that the risk of CL±P was increased in the offspring of the latter group (odds ratio (OR) = 1.68, 95 percent CI: 1.12, 2.52). Adjusting for maternal cigarette smoking and alcohol consumption had little impact on the results or interpretation of these analyses. Because this finding was true for all subsequent analyses, the results of only the unadjusted analyses are presented in this paper.
Maternal consumption of liver meals was not significantly related to the risk of CL±P (OR = 1.12, 95 percent CI: 0.72, 1.73). The risk of CL±P was also not significantly related to consumption of liver paste sandwiches measured as either a dichotomous (yes/no; OR = 1.03, 95 percent CI: 0.64, 1.67) or a continuous (OR (1 sandwich/week) = 0.98, 95 percent CI: 0.93, 1.02) variable.
Mean total daily vitamin A intake by case and control mothers was well below the level (≥7,500 RE or ~25,000 IU/day) thought to be teratogenic, and only a small proportion had mean intakes exceeding 3,030 RE/day (~10,000 IU/day) (table 1). Total daily vitamin A intake and daily intake of vitamin A from liver sources only were lower in mothers of CL±P infants than in mothers of both control and CP infants. Analysis of the relation between total daily vitamin A intake and CL±P provided evidence of a protective effect of vitamin A. For each increase in total vitamin A exposure of 500 RE/day, the odds of CL±P decreased by 0.88 (95 percent CI: 0.77, 1.01). Exploratory analyses were undertaken to determine whether the observed association between vitamin A and CL±P was independent of the effects of multivitamin use. The continuous variable, vitamin A exposure from liver products only, was not significantly related to CL±P in the total sample (table 1). However, examination of the distribution of vitamin A exposure from liver products indicated that mothers of CL±P infants were less likely than mothers of controls to be in the upper quartile of exposure (>857.1 RE/day, based on the distribution in controls). This trend was observed in the total study sample as well as in the subsets of subjects reporting no use and regular use of multivitamin supplements (table 2).
|
To further explore the relation between vitamin A exposure and CL±P, logistic regression analyses of the relation between CL±P and a dichotomous variable defined as vitamin A exposure from liver sources in the upper quartile of the distribution for controls were undertaken. In the total sample, there was evidence of a significant protective effect of vitamin A exposure from liver sources (OR = 0.60, 95 percent CI: 0.36, 0.98) (table 2). Similar, although nonsignificant associations were also observed in the subsets of subjects who were nonusers of multivitamin supplements (OR = 0.49, 95 percent CI: 0.18, 1.34) and regular users of multivitamin supplements (OR = 0.66, 95 percent CI: 0.36, 1.21). Furthermore, when both multivitamin use (nonuse and irregular use vs. regular use) and this dichotomous measure of vitamin A exposure were included in a logistic regression model, both variables remained significant (vitamin use: OR = 0.59, 95 percent CI: 0.39, 0.88; vitamin A from liver: OR = 0.58, 95 percent CI: 0.36, 0.96) (data not presented).
To determine whether the apparent effects of multivitamin use or vitamin A exposure from liver (<75th percentile/75th percentile) varied across RARA genotype, the joint distributions of these variables were examined. The ability to assess interactions involving RARA and these exposures was limited by the relatively small number of infants with the CT genotype. However, the data provided no compelling evidence that the joint effects of RARA and either measure of vitamin A exposure departed from additivity (multivitamin: synergy index = 3.82, 95 percent CI: 0.15, 96.06; liver: synergy index = 0.04, 95 percent CI: 23,163.00, 0.00) or multiplicativity (multivitamin:
21 = 0.75, p = 0.39; liver:
21 = 1.91, p = 0.17) (table 3).
|
CP
The odds ratio for the association between exposure to the RARA CT genotype and CP was 0.66 (95 percent CI: 0.13, 2.22); thus, this variant did not appear to be an important, independent determinant of CP in this population. The mothers of CP infants and the mothers of control infants were not significantly different with respect to the dichotomous variables: daily use of a multivitamin (OR = 0.92 , 95 percent CI: 0.51, 1.92 ), consumption of liver (OR = 1.02, 95 percent CI: 0.52, 1.97), or consumption of liver paste sandwiches (yes/no OR = 1.07, 95 percent CI: 0.52, 2.22; continuous OR = 1.0, 95 percent CI: 0.95, 1.06). Moreover, analysis of the relation between total daily vitamin A intake and CP provided no evidence of a protective effect of vitamin A (OR for 500 RE/day) = 0.97, 95 percent CI: 0.80, 1.18). Analyses of the interaction between RARA and vitamin A exposure were precluded because of the small number of case infants with the CT genotype (n = 3).
| DISCUSSION |
|---|
|
|
|---|
Our analyses of these data provide evidence that the risk of CL±P may be reduced by daily use of multivitamin supplements during the first trimester of pregnancy. This finding is consistent with a recent review of the literature (23), which suggests that maternal multivitamin supplementation is associated with a 3065 percent reduction in the risk of CL±P and has either no or a more modest impact on the risk of CP. It is unclear, and our data offer no insight, as to which component(s) of multivitamins might protect against CL±P. Although folic acid is a likely candidate (during the study period, multivitamins in Denmark included 100 µg of folic acid), the ability of folic acid to prevent oral clefts has not been firmly established (24).
Our analyses also indicate that, in this population, vitamin A intake from multivitamins and liver/liver products rarely exceeded 3,030 RE/day (10,000 IU/day)a level that has (inconsistently) been associated with an increased risk of fetal malformation. It is therefore not surprising that we found no evidence of an increased risk of oral clefts with increasing exposure to vitamin A from multivitamins and liver/liver products. Indeed, our analyses suggested that, within the range of vitamin A levels observed in this population, higher levels were protective against CL±P. This finding was not expected but could indicate that too little as well as too much vitamin A may be harmful to the developing embryo. Although our exploratory analyses suggested that vitamin A intake from liver sources was related to the risk of CL±P independent of the effects of multivitamins, this association was of only borderline significance and was based on a dichotomization of the exposure variable suggested by the data.
Several studies have provided evidence that variation in the RARA gene might influence the risk of CL±P (35). However, we found no evidence that the RARA variant evaluated in this study was related to the risk of either CL±P or CP. One possible explanation for this discrepancy is that the etiology of these conditions differs across study populations. However, the existence of large differences in the underlying causes of these conditions across study samples seems unlikely, since the familial aggregation patterns and epidemiologic characteristics of CL±P and CP tend to be quite similar across populations (25). Another possibility is that associations detected in previous case-control studies (3, 26) are attributable to confounding due to population stratification. Because Denmark is ethnically very homogenous and our study sample was limited to infants whose parents spoke Danish fluently, the potential for such confounding was minimized in the present study. Finally, it is possible that the difference in conclusions across studies reflects differences in the specific variant of RARA that was evaluated.
In the absence of a genetic variant that has a known impact on protein function, as is the case for RARA, selection of a polymorphism for study can be challenging. If previous studies have found an association with a particular variant, then it would seem reasonable to evaluate that variant in subsequent studies. However, in the case of RARA and facial clefts, two of the three positive-association studies evaluated polymorphisms outside of the RARA gene (4, 5). Although a third positive study used a restriction fragment length polymorphism in the RARA gene (3), the location of this site is unknown and could lie outside of the functional elements of the gene. Hence, none of the RARA variants that had previously been associated with facial clefts was an optimal candidate for subsequent studies.
To our knowledge, the present study is the first to evaluate the relation between facial clefts and this RARA variant. Given its location, this variant is relatively unlikely to have an impact on protein function. However, it is not unreasonable to speculate that it would be in linkage disequilibrium with another, functional variant within the RARA gene. Nonetheless, it is possible that RARA is related to the risk of CL±P and/or CP but that the variant evaluated in this study is neither the relevant variant nor in strong linkage disequilibrium with the relevant variant.
Our study had other limitations. First, the design made it impossible to blind the interviewers to the case-control status of a participant. However, the interviews were highly structured, and interviewers were monitored throughout the study period. Second, information on multivitamin use and liver consumption was obtained after the birth of an affected child and therefore was subject to recall bias. However, interview data regarding maternal smoking have been found to be valid (16), and it seems unlikely that multivitamin use or liver consumption would be subject to any greater degree of recall bias. Third, we did not account for sources of vitamin A supplements other than multivitamins, portion size for liver meals or liver paste sandwiches, or food sources of vitamin A other than liver. However, liver is likely to be one of the major determinants of dietary vitamin A intake in this population since cereals are not supplemented with vitamin A in Denmark. Fourth, the sample size resulted in limited power to detect gene-environment interactions. Finally, DNA samples were not available from the mothers of case and control infants; hence, maternal genetic effects exerted by the RARA locus could not be evaluated.
This study also had strengths, including a high participation rate and collection of exposure data within weeks of delivery of the infants. These aspects of the study should reduce concerns regarding the potentially biasing effects of nonparticipation and recall error, respectively. Concerns about the potentially biasing influence of population stratification were also minimized, since Denmark has a very ethnically homogeneous population. Furthermore, the study sample was limited to parents who spoke Danish fluently, and analysis of several genetic markers provided no evidence of genetic heterogeneity across the major region of Denmark (17).
In summary, our analyses provided no compelling evidence that the risk of CL±P or CP is related to the RARA variant analyzed. However, our analyses did provide further evidence for an association between maternal multivitamin use in the first trimester and a reduced risk of CL±P. Although this finding is not novel, it is of particular importance because ethical constraints are likely to preclude a placebo-controlled, randomized clinical trial of multivitamin supplementation for preventing oral clefts. Until acceptable trials can be implemented, conclusions regarding the relation between multivitamins and oral clefts are likely to be largely informed by the results of studies such as this one.
| ACKNOWLEDGMENTS |
|---|
This work was supported by Danish grants from The Egmont Foundation, Helsefonden (11/076-91, 11/027-92, and 11/062-93) and Laegeforeningens Forskingsfond (J.086.51) and by US grants from the National Institute of Dental and Craniofacial Research (DE11948 and DE08559).
The authors express their gratitude to Drs. Jorn Olsen, Bent Norgaard-Pedersen, and Olga Basso for their help in establishing the resources upon which this study was based; Allison Weber and Bonnie Ludwig for technical assistance; and the study interviewers: Elisabeth Bayer, Birthe Granhof Black, Anne Marie Frydendall, Jette Gertz, Jyttte Gregersen, Jette Moes, Annegrethe Pedersen, Kirsten Plesner (deceased), Marjun Reines, Emma Sakstrup, Lisa Smedegaard, and Vibeke Thinggaard.
| NOTES |
|---|
Reprint requests to Dr. Kaare Christensen, Center for Prevention of Congenital Malformations, Institute of Public Health, University of Southern Denmark, Sdr. Boulevard 23A, DK-5000 Odense C, Denmark (e-mail: Kchristensen{at}health.sdu.dk).
| REFERENCES |
|---|
|
|
|---|
- Wyszynski DF, Beaty TH. Review of the role of potential teratogens in the origin of human nonsyndromic oral clefts. Teratology 1996;53:30917.[CrossRef][Web of Science][Medline]
- Schutte BC, Murray JC. The many faces and factors of orofacial clefts. Hum Mol Genet 1999;8:18539.
[Abstract/Free Full Text] - Chenevix-Trench G, Jones K, Green A, et al. Cleft lip with or without cleft palate: associations with the transforming growth factor alpha and retinoic acid receptor loci. Am J Hum Genet 1992;51:137785.[Web of Science][Medline]
- Shaw D, Ray A, Marazita M, et al. Further evidence of a relationship between the retinoic acid receptor alpha locus and nonsyndromic cleft lip with or without cleft palate. Am J Hum Genet 1993;53:11567.[Web of Science][Medline]
- Maestri NE, Beaty TH, Hetmanski JB, et al. Application of transmission disequilibrium tests to nonsyndromic oral clefts: including candidate genes and environmental exposures in the models. Am J Med Genet 1997;73:33744.[CrossRef][Web of Science][Medline]
- Collins MD, Mao GE. Teratology of retinoids. Annu Rev Pharmacol Toxicol 1999;39:399403.[CrossRef][Web of Science][Medline]
- Morriss-Kay GM, Ward SJ. Retinoids and mammalian development. Int Rev Cytol 1999;188:73130.[Web of Science][Medline]
- Rothman KJ, Moore LL, Singer MR, et al. Teratogenicity of high vitamin A intake. N Engl J Med 1995;333:136973.
[Abstract/Free Full Text] - Martinez-Frias ML, Salvador J. Epidemiological aspects of prenatal exposure to high doses of vitamin A in Spain. Eur J Epidemiol 1990;6:11823.[CrossRef][Web of Science][Medline]
- Shaw GM, Wasserman CR, Lammer EJ, et al. Orofacial clefts, parental cigarette smoking, and transforming growth factor-alpha gene variants. Am J Hum Genet 1996;58:55161.[Web of Science][Medline]
- Mills JL, Simpson JL, Cunningham GC, et al. Vitamin A and birth defects. Am J Public Health 1997;177:316.
- Mastroiacovo P, Mazzone T, Aderem A, et al. High vitamin A intake in early pregnancy and major malformations: a multicenter prospective controlled study. Teratology 1999;59:711.[CrossRef][Web of Science][Medline]
- van den Berg H, Hulshof KF, Deslypere JP, et al. Evaluation of the effect of the use of vitamin supplements on vitamin A intake among (potentially) pregnant women in relation to the consumption of liver and liver products. Eur J Obstet Gynecol Reprod Biol 1996;66:1721.[CrossRef][Web of Science][Medline]
- Arnhold T, Tzimas G, Wittfoht W, et al. Identification of 9-cis-retinoic acid, 9, 13-di-cis-retionic acid, and 14-hydroxy-4, 14-retro-retinol in human plasma after liver consumption. Life Sci 1996;59:16977.[CrossRef][Web of Science][Medline]
- van Vliet T, Boelsma E, de Vries AJ, et al. Retinoic acid metabolites in plasma are higher after intake of liver paste compared with a vitamin A supplement in women. J Nutr 2001;131:3197203.
[Abstract/Free Full Text] - Christensen K, Olsen J, Nørgaard-Pedersen B, et al. Oral clefts, transforming growth factor alpha gene variants, and maternal smoking: a population-based case-control study in Denmark, 19911994. Am J Epidemiol 1999;149:24855.
[Abstract/Free Full Text] - Mitchell LE, Murray JC, OBrien S, et al. Evaluation of two putative susceptibility loci for oral clefts in the Danish population. Am J Epidemiol 2001;153:100715.
[Abstract/Free Full Text] - Jacobsen JS, Leth T. A vitamin in liver. Copenhagen, Denmark: The National Food Agency of Denmark, Institute of Food Safety and Nutrition, 1995. (Publication no. 8).
- Moller R. Levnedsmiddeltabeller (The composition of food). (In Danish). Copenhagen, Denmark: Levnedmiddelstyrelsen, 1996.
- SAS Institute, Inc. SAS software, version 8.01. Cary, NC: SAS Institute, Inc, 1999.
- Dean AG, Dean JA, Coulombier D, et al. Epi Info, version 6.0: a word processing, database and statistics program for epidemiology on microcomputers. Atlanta, GA: Centers for Disease Control and Prevention, 1994.
- Hosmer DW, Lemeshow S. Confidence interval estimation of interaction. Epidemiology 1992;3:4526.[Web of Science][Medline]
- Itikala PR, Watkins ML, Mulinare J, et al. Maternal multivitamin use and orofacial clefts in offspring. Teratology 2001;63:7986.[CrossRef][Web of Science][Medline]
- Mills JL. Folate and oral clefts: where do we go from here? New directions in oral clefts research. Teratology 1999;60:2512.[CrossRef][Web of Science][Medline]
- Mitchell LE. Genetic epidemiology of birth defects: nonsyndromic cleft lip and neural tube defects. Epidemiol Rev 1997;19:618.
[Free Full Text] - Vintiner GM, Lo KK, Holder SE, et al. Exclusion of candidate genes from a role in cleft lip with or without cleft palate: linkage and association studies. J Med Genet 1993;30:7738.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
C. Y Johnson and J. Little Folate intake, markers of folate status and oral clefts: is the evidence converging? Int. J. Epidemiol., October 1, 2008; 37(5): 1041 - 1058. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. W. Johansen, R. T. Lie, A. J. Wilcox, L. F. Andersen, and C. A. Drevon Maternal Dietary Intake of Vitamin A and Risk of Orofacial Clefts: A Population-based Case-Control Study in Norway Am. J. Epidemiol., May 15, 2008; 167(10): 1164 - 1170. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yu, J. Han, J. Lin, Y. Xiao, X. Zhang, and Y. Li Apoptosis Induced by atRA in MEPM Cells Is Mediated through Activation of Caspase and RAR Toxicol. Sci., February 1, 2006; 89(2): 504 - 509. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


