American Journal of Epidemiology Vol. 153, No. 7 : 673-679
Copyright © 2001 by The Johns Hopkins University School of Hygiene and Public Health
ORIGINAL CONTRIBUTIONS |
Methylenetetrahydrofolate Reductase 677 C/T Genotype and Cardiovascular Disease Mortality in Postmenopausal Women
1 Julius Center for Patient Oriented Research, Utrecht University Medical School, Utrecht, The Netherlands.
2 Department of Hematology, Utrecht University Medical School, Graduate School of Biomembranes, Utrecht, The Netherlands
3 Department of Internal Medicine, Utrecht University Medical School, Utrecht, The Netherlands.
| ABSTRACT |
|---|
|
|
|---|
Methylenetetrahydrofolate reductase (MTHFR) is involved in the reduction of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate. A 677 C/T single nucleotide polymorphism localized in the MTHFR gene is associated with both thermolability and reduced activity of the enzyme and is associated with increased homocysteine levels. The authors investigated the relation between the MTHFR 677 C/T polymorphism and risk of cardiovascular disease mortality in a cohort study of 12,239 women initially aged 5267 years with a maximum follow-up time of 18 years (19761995; 153,732 woman-years of follow-up). The cardiovascular disease mortality rate was highest among women with the MTHFR 677 CC wild-type genotype and lowest among MTHFR 677 TT homozygotes. In comparison with women with the 677 CC wild-type genotype, age-adjusted rate ratios were 0.7 (95% confidence interval: 0.5, 0.9) for 677 CT heterozygotes and 0.6 (95% confidence interval: 0.4, 1.0) for 677 TT homozygotes. The possibility that this relation is a chance finding must be considered, because the relation is weak and of borderline significance. However, it provides an important argument against the view that increased levels of homocysteine directly raise cardiovascular disease risk.
cardiovascular diseases; genotype; hyperhomocysteinemia; mortality; postmenopause; women
Abbreviations: CI, confidence interval; DOM, Doorlopend Onderzoek Morbiditeit/Mortaliteit; ICD-9, International Classification of Diseases, Ninth Revision; MTHFR, methylenetetrahydrofolate reductase.
| INTRODUCTION |
|---|
|
|
|---|
Because hyperhomocysteinemia is associated with an increased risk of cardiovascular disease (1
Methylenetetrahydrofolate reductase (MTHFR) is a critical enzyme in folate metabolism, and it may play a role in both cancer and cardiovascular disease (3
, 4
). It is involved in the reduction of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, which transforms homocysteine into methionine (5
). However, if 5,10-methylenetetrahydrofolate is not reduced to 5-methyltetrahydrofolate, it can either transfer its methylene group to deoxyuridylate to synthesize deoxythymidilate or be oxidized to 5,10-methenyl-tetrahydrofolate, which in turn is converted to 10-formyl-tetrahydrofolate (5
). Both processes act independently of MTHFR. Studies have suggested that a high proportion of formylated folates may protect against cancer via DNA synthesis and repair processes that are dependent on nonmethylated forms of folate (4
, 5
).
Recently, a 677 C/T single nucleotide polymorphism was localized in the MTHFR gene (6
). This polymorphism codes for the substitution of valine for alanine at position 226 of the protein. Compared with the MTHFR 677 C wild-type variant, the 677 T variant is less resistant to heat inactivation and is associated with reduced enzyme activity (7
). It is also associated with increased homocysteine levels (8![]()
10
) and the increased availability of nonmethylated forms of folate (5
). Both of these factors may be involved in cardiovascular disease. Results of studies carried out to date on the relation between the MTHFR 677 C/T genotype and cardiovascular disease (reviewed by Fletcher and Kessling (11
) and meta-analyzed by Brattstrom et al. (12
)) have been inconclusive.
To acquire more data in this area, we investigated the relation between MTHFR 677 C/T genotype and cardiovascular disease mortality. Our study was based on a population of 12,239 women initially aged 5267 years who were followed for cardiovascular disease mortality between 1976 and 1995 (13
). It enabled us to study the direct relation between the 677 T variant of the MTHFR gene and cardiovascular disease mortality in postmenopausal women.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Population
Between December 1974 and October 1980, a total of 20,555 women born between 1911 and 1925 and residing in the city of Utrecht, The Netherlands, were asked to participate in an experimental breast cancer screening program, Doorlopend Onderzoek Morbiditeit/Mortaliteit (The DOM Project) (13
Risk factors
Each woman completed a questionnaire at baseline regarding use of medication, prescribed diets, history and presence of cardiovascular disease, and smoking. Blood pressure, height (m), and weight (kg) were measured at that time. The women were classified as having diabetes mellitus if they either used insulin or oral blood glucose-lowering drugs or were on a diabetes diet. They were defined as smokers if they smoked at baseline. Body mass index was calculated as weight (kg) divided by height squared (m2). Obesity was defined as a body mass index
30.
Endpoints
Municipal registries regularly provided information regarding the migration and/or mortality of the DOM cohort members to the Department of Epidemiology (now the Julius Center for Patient Oriented Research) at Utrecht University Medical School. General practitioners were used as the source of information from treating physicians, and they based their diagnoses on all available clinical information. Mortality was coded according to the International Classification of Diseases, Ninth Revision (ICD-9) (41
). Mortality from myocardial infarction was defined as ICD-9 codes 410414, cerebrovascular mortality as ICD-9 codes 430439, and other cardiovascular disease mortality as all remaining ICD-9 codes between 390 and 460. Subjects who were lost to follow-up were withdrawn from the study at the time point at which they had become lost. The 9,062 surviving women had a median follow-up time of 17 years, with a maximum of 18 years. A total of 1,447 women (11.8 percent) had moved outside of the recruitment area and had a median follow-up of 10 years, with a maximum of 18 years. The number of deaths occurring during follow-up (153,732 woman-years) totaled 1,714. There were 608 deaths from cardiovascular disease (ICD-9 codes 390459), 601 from neoplasms (ICD-9 codes 140239), 299 from other causes, and 206 from unknown causes.
Design
The present results are based on a case-control analysis nested within the DOM cohort (14
). This type of analysis allows the use of information from the entire cohort and the acquisition of unbiased risk estimates while keeping laboratory work within manageable bounds. All 608 women who died of cardiovascular disease constituted the cases, while a random sample of 618 subjects from the cohort of 11,631 women who did not die of cardiovascular disease constituted the controls (sampling fraction 1:18.8). Urine samples from 59 cardiovascular disease cases and 49 controls were either not collected at baseline or lost during follow-up. DNA samples from 48 cardiovascular disease cases and 54 controls were not suitable for analysis. Therefore, the final study group comprised 501 cases of cardiovascular disease mortality and 515 controls.
Genotyping
DNA was isolated from 50-ml urine samples (15
). A 198-base-pair fragment of the MTHFR gene, which contained nucleotide 677, was amplified in 20 mm Tris/hydrochloric acid (pH 8.0), 2.5 mm magnesium chloride, 50 mm potassium chloride, 0.1 mg/ml bovine serum albumin, 0.4 pmol of the primer TGAAGGAGAAGGTGTCTTGCGGGA', 0.4 pmol of the primer ACCAGAACAATTCGTGACCCGT', 0.42 mm of each nucleotide (Pharmacia LKB Bio-technology, Uppsala, Sweden), 0.075 IU superTAQ polymerase (HT Biotechnology Ltd., Cambridge, United King-dom), and 5 ml of DNA, using an MJ Research PTC200 multicycler (MJ Research, Watertown, Massachusetts). Temperature cycles were as follows: 4 minutes at 94°C, 33 cycles of 40 seconds at 94°C, 40 seconds at 55°C, and 2 minutes at 72°C. The reaction was terminated with a 10-minute incubation at 72°C. Genotype was determined from each DNA fraction by hybridization with antigen-specific oligonucleotides (15
). The antigen-specific oligonucleotide for the 677 C allele was g32P-TGCGGGAGCCGATTTCAT, and the antigen-specific oligonucleotide for the 677 T allele was g32P-TGCGGGAGTCGATTTCAT. Dots were visualized on radiographic film after overnight radiation. Mutation analysis was performed with the samples blinded as to case/control status.
Data analysis
Mean values and proportions for baseline cardiovascular disease risk factors were computed separately for women with the MTHFR 677 CC, 677 CT, and 677 TT genotypes. The significance of differences between means was tested using analysis of variance, while the significance of differences between proportions was tested using
2 statistics. Allele frequencies were calculated according to the law of Hardy-Weinberg (16
, 17
). The
2 goodness-of-fit test was used to determine whether the observed numbers of each genotype were in equilibrium.
A nested case-control approach was used to estimate incidence rates and rate ratios (14
). The control group was a random sample of all women who did not die of cardiovascular disease (sampling fraction 1:18.8). Since the controls were selected at random, the data from our control group provide unbiased estimates for the entire cohort of women who did not die of cardiovascular disease. After MTHFR genotype was determined, we estimated years of follow-up for the entire cohort for each genotype by weighting the follow-up years of the control group by 18.8 (the inverse of the sampling fraction) and taking the true follow-up years from the cardiovascular disease mortality cases. Incidence rates were calculated as the number of incidents per genotype divided by the estimated number of follow-up years for that genotype (14
). We then calculated the incidence rate ratio as the incidence rate for cardiovascular disease among either 677 TT homozygotes or 677 CT heterozygotes divided by the incidence rate in women with the 677 CC wild-type genotype (hereafter called wild-types). Poisson regression was used to estimate incidence rates and risk ratios; 95 percent confidence intervals were calculated according to the method of Huber (18
).
The crude relative risks, incidence rates, and rate ratios were estimated in the same way for women who died of myocardial infarction (ICD-9 codes 410414), women who died of cerebrovascular disease (ICD-9 codes 430438), and women who died of other cardiovascular diseases (all remaining ICD-9 codes between 390 and 459). A multivariate model was used to correct for age at study entry, while the presence of effect modification was investigated using subgroup analyses on age (above or below the median), smoking (yes/no), obesity (yes/no), and hypertension (yes/no).
Pooled analysis
A meta-analysis of 23 studies on the relation between MTHFR 677 C/T genotype and all forms of cardiovascular disease was published recently (12
). We used the data from these 23 studies to conduct a pooled analysis. The numbers of MTHFR 677 CC wild-types, MTHFR CT heterozygotes, and MTHFR TT homozygotes were pooled according to angiographically assessed coronary artery stenosis (19![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
28
), incidence of myocardial infarction (9
, 29![]()
31
), a combination of the two (32![]()
![]()
![]()
![]()
37
), incidence of stroke (38
), and incidence of deep venous thrombosis (39
, 40
); their related control groups were also pooled. We then calculated odds ratios and 95 percent confidence intervals for relations between 677 CT heterozygotes and 677 CC wild-types and between 677 TT homozygotes and 677 CC wild-types.
| RESULTS |
|---|
|
|
|---|
The general characteristics of the study population are given in table 1. Mean age and mean body mass index were similar for all MTHFR genotypes in both groups of women. In the group of women who died of cardiovascular disease, diastolic blood pressure was slightly higher for MTHFR 677 TT homozygotes than for 677 CT heterozygotes and 677 CC wild-types (p = 0.05). In the randomly selected control group, there was no difference in blood pressure among MTHFR genotypes. The numbers of women with a history of diabetes, women with symptomatic cardiovascular disease, and smokers were equally distributed among the MTHFR genotypes in both groups. The genotype distribution was in Hardy-Weinberg equilibrium for both the study group and the controls. We also analyzed the relation between the MTHFR 677 C/T polymorphism and myocardial infarction both including and excluding our results from the analysis.
|
The incidence rates for mortality due to myocardial infarction, cerebrovascular events, and all other cardiovascular disease events were highest for MTHFR 677 CC wild-types and lowest for MTHFR 677 TT homozygotes (table 2). In fact, when adjusted for age, the incidence rate ratios for total cardiovascular disease mortality in the MTHFR 677 TT group reached statistical significance (table 3). Compared with the reference group of MTHFR 677 CC wild-types, the incidence rate ratios for cardiovascular disease mortality were 0.7 (95 percent confidence interval (CI): 0.5, 0.9) for MTHFR 677 CT heterozygotes and 0.6 (95 percent CI: 0.4, 1.0) for MTHFR 677 TT homozygotes. Negative associations between the MTHFR 677 T allele and cardiovascular disease mortality were found for fatal myocardial infarction, cerebrovascular disease mortality, and the remaining group of all other types of cardiovascular disease mortality. However, these associations did not reach statistical significance. Adjustment for blood pressure, diabetes, smoking, and body mass index had no effect on the incidence rates (data not presented). Subgroup analysis also had no effect on these parameters.
|
|
Table 4 presents results from the pooled analysis of data from 23 studies, both with and without inclusion of our findings, on the relation between MTHFR 677 C/T genotype and angiographically assessed coronary artery stenosis, incidence of myocardial infarction, both outcomes combined, stroke, and deep venous thrombosis. MTHFR 677 TT homozygotes had an odds ratio for angiographically assessed coronary artery stenosis of 1.30 (95 percent CI: 1.11, 1.53) when compared with MTHFR 677 CC wild-types. Moreover, the risk of myocardial infarction was significantly lower for MTHFR 677 TT homozygotes than for MTHFR 677 CC wild-types; the odds ratio was 0.79 (95 percent CI: 0.61, 1.02) when our data were not included in the pooled analysis and 0.77 (95 percent CI: 0.61, 0.97) when our data were included. We also found that the MTHFR 677 C/T polymorphism was associated with a nonsignificant reduced risk of stroke, while there was no relation between the MTHFR 677 C/T polymorphism and deep venous thrombosis.
|
| DISCUSSION |
|---|
|
|
|---|
The results of our study do not support the possibility of a relation between the MTHFR 677 C/T single nucleotide polymorphism and an increased risk of cardiovascular disease mortality in postmenopausal women. If anything, the MTHFR 677 C/T polymorphism may predict a lower cardiovascular disease mortality risk. The cardiovascular disease mortality rate was 3.7 per 1,000 woman-years (95 percent CI: 3.1, 4.4) for MTHFR 677 CC wild-types, 3.0 (95 percent CI: 2.5, 3.6) for 677 CT heterozygotes, and 2.7 (95 percent CI: 1.8, 3.9) for MTHFR 677 TT homozygotes, which suggests a causal relation.
In interpreting these findings, one must consider some of the characteristics of this study. All data were obtained from a large cohort study of 12,239 women who were followed with regard to mortality for approximately 18 years (153,732 woman-years of follow-up). In contrast to most case-control studies, cohort studies are not sensitive to selection bias either in cases or in controls and are less sensitive to information bias. An additional advantage of our study was its prospective approach, which enabled us to study cardiovascular disease mortality. The probability that our findings can be explained by measurement error or misclassification with regard to genotype is negligible, because the investigator was blinded to the case/control status of the DNA sample and all measurements were performed in duplicate. Moreover, the MTHFR C/T genotype distribution in both samples was in Hardy-Weinberg equilibrium, and the allele frequencies in the control sample were similar to previously reported allele frequencies (11
, 12
).
One disadvantage of our study design was that no blood samples were collected at baseline, so it was not possible to study the relation between the MTHFR 677 C/T polymorphism and plasma homocysteine levels or activity. This is not a serious limitation, however, since these relations have already been described in several large studies (8
, 9
). Another disadvantage was that we were not able to study possible effect modification by folate intake or status on the relation between the MTHFR 677 C/T polymorphism and cardiovascular disease mortality.
Our findings of a borderline significant lower risk of myocardial infarction in MTHFR 677 TT homozygotes compared with MTHFR 677 CC wild-types is observed in the majority of studies on the relation between the MTHFR 677 C/T polymorphism and myocardial infarction. When we pooled the data from all of these studies (9
, 28![]()
![]()
31
) (table 4), we found that MTHFR 677 TT homozygotes had an odds ratio for myocardial infarction of 0.77 (95 percent CI: 0.63, 0.95) in comparison with MTHFR 677 CC wild-types. Remarkably, in the pooled analysis of published studies (19![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
28
), we found an association between the MTHFR 677 C/T polymorphism and increased prevalence of angiographically assessed coronary artery stenosis (odds ratio = 1.30; 95 percent CI: 1.11, 1.53) (table 4). The paradoxical findings between the MTHFR 677 C/T polymorphism and lower incidence of myocardial infarction on the one hand and increased angiographically assessed coronary artery stenosis on the other may be explained by the selective dropout of incident cases of myocardial infarction from the coronary stenosis population. Prevalent coronary stenosis is an intermediate stage of cardiovascular disease pathology, which only leads to myocardial infarction when triggered by factors that are involved in coronary occlusion. Although those subjects are the most interesting cases, they were not available as study cases. The consequence of this survival bias is that true risk factors for myocardial infarction will be underrepresented among cases with prevalent atherosclerosis when compared with controls. In other words, the MTHFR 677 C/T polymorphism may be associated with a reduced risk of myocardial infarction in coronary stenosis patients and therefore may be overrepresented in coronary stenosis populations.
Our finding that the MTHFR 677 C/T polymorphism was associated with lower risk of cardiovascular disease mortality may be a chance finding, because the observed relation was weak and only borderline significant, even in the pooled analysis. Additional data from large cohort studies will be required in order to draw firm conclusions from our observations. If the relation between genetic predisposition to mild homocysteinemia and reduced risk of cardiovascular disease can be confirmed in other prospective studies, then alternative pathways of folate metabolism must be considered as explanations for the reduced risk. Nonmethylated folate may induce a metabolic condition favoring DNA synthesis and repair (5
), which may yield increased vascular remodeling.
We conclude that genetic predisposition to moderate hyperhomocysteinemia is not associated with an increased risk of cardiovascular disease mortality.
| ACKNOWLEDGMENTS |
|---|
The Netherlands Heart Foundation is gratefully acknowledged for its financial contribution to the project.
| NOTES |
|---|
Correspondence to Dr. Mark Roest, Department of Clinical Chemistry, G03-647, Utrecht University Medical School, Heidelberglaan 100, 3584 CX Utrecht, The Netherlands (e-mail: m.roest{at}jc.azu.nl).
| REFERENCES |
|---|
|
|
|---|
-
Stampfer MJ, Malinow MR, Willett WC, et al. A prospective study of plasma homocyst(e)ine and risk of myocardial infarction in US physicians. JAMA 1992;268:87781.
[Abstract/Free Full Text] -
Selhub J, Jacques PF, Bostom AG, et al. Association between plasma homocysteine concentrations and extracranial carotid-artery stenosis. N Engl J Med 1995;332:28691.
[Abstract/Free Full Text] - Kang SS, Wong PW, Susmano A, et al. Thermolabile methy-lenetetrahydrofolate reductase: an inherited risk factor for coronary artery disease. Am J Hum Genet 1991;48:53645.[Web of Science][Medline]
-
Ma J, Stampfer MJ, Giovannucci E, et al. Methylenetetra-hydrofolate reductase polymorphism, dietary interactions, and risk of colorectal cancer. Cancer Res 1997;57:1098102.
[Abstract/Free Full Text] -
Bagley PJ, Selhub J. A common mutation in the methylenetet-rahydrofolate reductase gene is associated with an accumulation of formylated tetrahydrofolates in red blood cells. Proc Natl Acad Sci U S A 1998;95:1321720.
[Abstract/Free Full Text] - Frosst P, Blom HJ, Milos R, et al. A candidate genetic risk factor for vascular disease: a common mutation in methylenetet-rahydrofolate reductase. (Letter). Nat Genet 1995;10:11113.[Web of Science][Medline]
- Engbersen AM, Franken DG, Boers GH, et al. Thermolabile 5,10-methylenetetrahydrofolate reductase as a cause of mild hyperhomocysteinemia. Am J Hum Genet 1995;56:14250.[Web of Science][Medline]
-
Jacques PF, Bostom AG, Williams RR, et al. Relation between folate status, a common mutation in methylenetetrahydrofolate reductase, and plasma homocysteine concentrations. Circulation 1996;93:79.
[Abstract/Free Full Text] -
Ma J, Stampfer MJ, Hennekens CH, et al. Methylenetetra-hydrofolate reductase polymorphism, plasma folate, homocysteine, and risk of myocardial infarction in US physicians. Circulation 1996;94:241016.
[Abstract/Free Full Text] - Motti C, Gnasso A, Bernardini S, et al. Common mutation in methylenetetrahydrofolate reductase: correlation with homocysteine and other risk factors for vascular disease. Atherosclerosis 1998;139:37783.[Web of Science][Medline]
- Fletcher O, Kessling AM. MTHFR association with arteriosclerotic vascular disease? Hum Genet 1998;103:1121.[Web of Science][Medline]
-
Brattstrom L, Wilcken DE, Ohrvik J, et al. Common methy-lenetetrahydrofolate reductase gene mutation leads to hyperhomocysteinemia but not to vascular disease: the result of a meta-analysis. Circulation 1998;98:25206.
[Abstract/Free Full Text] - de Waard F, Collette HJ, Rombach JJ, et al. The DOM Project for the early detection of breast cancer, Utrecht, The Netherlands. J Chronic Dis 1984;37:144.[Web of Science][Medline]
-
Miettinen OS. Proportion of disease caused or prevented by a given exposure, trait or intervention. Am J Epidemiol 1974;99:32533.
[Abstract/Free Full Text] -
Roest M, Banga JD, de Valk B, et al. The factor V Arg506Gln mutation is not associated with cardiovascular mortality in older women. Am J Epidemiol 1998;149:66570.
[Abstract/Free Full Text] - Hardy GH. Mendelian proportions in mixed population. Science 1908;28:4150.
- Weinberg W. On demonstration of heredity in man. Englewood Cliffs, NJ: Prentice-Hall, 1963.
- Huber PJ. The behavior of maximum likelihood estimates under non-standard conditions. Proc Fifth Berkeley Symp Math Stat Probabil 1967;1:22133.
-
Verhoef P, Kok FJ, Kluijtmans LA, et al. The 677C
T mutation in the methylenetetrahydrofolate reductase gene: associations with plasma total homocysteine levels and risk of coronary atherosclerotic disease. Atherosclerosis 1997;132:10513.[Web of Science][Medline]
-
Kluijtmans LA, Kastelein JJ, Lindemans J, et al. Thermolabile methylenetetrahydrofolate reductase in coronary artery disease. Circulation 1997;96:25737.
[Abstract/Free Full Text] -
Christensen B, Frosst P, Lussier-Cacan S, et al. Correlation of a common mutation in the methylenetetrahydrofolate reductase gene with plasma homocysteine in patients with premature coronary artery disease. Arterioscler Thromb Vasc Biol 1997;17:56973.
[Abstract/Free Full Text] -
Callagher PM, McCleady R, Shields DC, et al. Homocysteine and risk of premature coronary heart disease: evidence for a common gene mutation. Circulation 1996;94:21548.
[Abstract/Free Full Text] - Izumi M, Iwai N, Ohmichi N, et al. Molecular variant of 5,10-methylenetetrahydrofolate reductase is a risk factor of ischaemic heart disease in the Japanese population. Atherosclerosis 1996;121:2934.[Web of Science][Medline]
- Wilcken DE, Wang XL, Wilcken B. Methylenetetrahydrofolate reductase (MTHFR) mutation, homocyst(e)ine, and coronary artery disease. (Letter). Circulation 1997;96:273840.
- Narang R, Callaghan G, Haider AW, et al. Methylenetetra-hydrofolate reductase mutation and coronary artery disease. Circulation 1996;94:23223.
-
van Bockxmeer FM, Mamotte CD, Vasikaran SD, et al. Methylenetetrahydrofolate reductase gene and coronary artery disease. Circulation 1997;95:213.
[Abstract/Free Full Text] - Morita H, Taguchi J, Kurihara H, et al. Gene polymorphism of 5,10-methylenetetrahydrofolate reductase as a coronary risk factor. J Cardiol 1997;29:30915.[Web of Science][Medline]
-
Verhoef P, Rimm EB, Hunter DJ, et al. A common mutation in the methylenetetrahydrofolate gene and risk of coronary heart disease: results among U.S. men. J Am Coll Cardiol 1998;32:3539.
[Abstract/Free Full Text] -
Schmitz C, Lindpaintner K, Verhoef P, et al. Genetic polymorphism of methylenetetrahydrofolate reductase and myocardial infarction: a case-control study. Circulation 1996;94:181214.
[Abstract/Free Full Text] -
Schwartz SM, Siscovick DS, Malinow MR, et al. Myocardial infarction in young women in relation to plasma total homocysteine, folate, and a common variant in the methylenetet-rahydrofolate reductase gene. Circulation 1997;96:41217.
[Abstract/Free Full Text] -
Adams M, Smith PD, Martin D, et al. Genetic analysis of thermolabile methylenetetrahydrofolate reductase as a risk factor for myocardial infarction. QJM 1996;89:43744.
[Abstract/Free Full Text] - Kluijtmans LA, van den Heuvel LP, Boers GH, et al. Molecular genetic analysis in mild hyperhomocysteinemia: a common mutation in the methylenetetrahydrofolate reductase gene is a genetic risk factor for cardiovascular disease. Am J Hum Genet 1996;58:3541.[Web of Science][Medline]
-
Deloughery TG, Evans A, Sadeghi A, et al. Common mutation in methylenetetrahydrofolate reductase: correlation with homocysteine metabolism and late-onset vascular disease. Circulation 1996;94:30748.
[Abstract/Free Full Text] -
de Franchis R, Mancini FP, D'Angelo A, et al. Elevated total plasma homocysteine and 677C
T mutation of the 5,10-methylenetetrahydrofolate reductase gene in thrombotic vascular disease. (Letter). Am J Hum Genet 1996;59:2624.[Web of Science][Medline]
- Brulhart MC, Dussoix P, Ruiz J, et al. The (Ala-Val) mutation of methylenetetrahydrofolate reductase as a genetic risk factor for vascular disease in non-insulin-dependent diabetic patients. Am J Hum Genet 1997;60:2289.[Web of Science][Medline]
- Brugada R, Marian AJ. A common mutation in methylenetet-rahydrofolate reductase gene is not a major risk of coronary artery disease or myocardial infarction. Atherosclerosis 1997;128:10712.[Web of Science][Medline]
-
Malinow MR, Nieto FJ, Kruger WD, et al. The effects of folic acid supplementation on plasma total homocysteine are modulated by multivitamin use and methylenetetrahydrofolate reductase genotypes. Arterioscler Thromb Vasc Biol 1997;17:115762.
[Abstract/Free Full Text] -
Markus HS, Ali N, Swaminathan R, et al. Common polymorphism in the methylenetetrahydrofolate reductase gene, homocysteine, and ischemic cerebrovascular disease. Stroke 1997;28:173943.
[Abstract/Free Full Text] - Tosetto A, Missiaglia E, Frezzato M, et al. The VITA Project: C677T mutation in the methylene-tetrahydrofolate reductase gene and risk of venous thromboembolism. Br J Haematol 1997;97:8046.[Web of Science][Medline]
- Salden A, Keeney S, Hay CR, et al. The C677T MTHFR variant and the risk of venous thrombosis. (Letter). Br J Haematol 1997;99:472.[Web of Science][Medline]
- International classification of diseases. Manual of the international statistical classification of diseases, injuries, and causes of death. Ninth Revision. Geneva, Switzerland: World Health Organization, 1977.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R. Y.L. Zee, S. Mora, S. Cheng, H. A. Erlich, K. Lindpaintner, N. Rifai, J. E. Buring, and P. M Ridker Homocysteine, 5,10-Methylenetetrahydrofolate Reductase 677C>T Polymorphism, Nutrient Intake, and Incident Cardiovascular Disease in 24 968 Initially Healthy Women Clin. Chem., May 1, 2007; 53(5): 845 - 851. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bathum, J. v. B. Hjelmborg, L. Christiansen, M. McGue, B. Jeune, and K. Christensen Methylenetetrahydrofolate Reductase 677C>T and Methionine Synthase 2756A>G Mutations: No Impact on Survival, Cognitive Functioning, or Cognitive Decline in Nonagenarians J. Gerontol. A Biol. Sci. Med. Sci., February 1, 2007; 62(2): 196 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Klerk, P. Verhoef, R. Clarke, H. J. Blom, F. J. Kok, E. G. Schouten, and and the MTHFR Studies Collaboration Group MTHFR 677C->T Polymorphism and Risk of Coronary Heart Disease: A Meta-analysis JAMA, October 23, 2002; 288(16): 2023 - 2031. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
677 C/T genotype and cardiovascular disease risk: The DOM

